Actualité :
Frederick Sanger nous a quitté

Frederick Sanger (1918 - 2013)

Frederick Sanger (1918 - 2013)

Si la nouvelle ne vous est pas encore parvenue, nous vous annonçons que Frederick Sanger, le père de la génomique, est décédé le mardi 19 novembre 2013 à l'âge de 95 ans.

Frederick Sanger est né en 1918 dans un petit village du Gloucestershire en Angleterre. Il étudie les sciences naturelles dans le prestigieux Saint John's College de Cambridge, puis effectue une thèse en métabolisme dans le département de biochimie de l'University of Cambridge. Suite à sa thèse, il enchaîne dans le même laboratoire sur l'étude de la composition de l'insuline. En moins de dix ans (de 1943 à 1951), il met en place une méthode de séquençage de protéine qui lui permet de déterminer la séquence d'acides aminés complète des deux chaînes composant l'insuline bovine. Ces travaux, qui font tomber le dogme de l'époque selon lequel les protéines était des molécules amorphes, sont plus que récompensés par l'obtention du prix Nobel de chimie en 1958.

En 1951, il quitte l'université de Cambridge pour travailler en tant que membre du Medical Research Council (MRC) où il prend un peu plus tard la tête du département de chimie protéique. Après avoir triomphé des protéines, Frederick se donne comme challenge de venir à bout de la séquence de l'ARN de transfert (ARNt) de S. cerevisiae, en compétition avec deux autres laboratoires. Il perd la course mais publie néanmoins la séquence de l'ARN ribosomal 5S d'E. coli.

Après avoir percé les secrets de l'ARN, Frederick Sanger s'attaque finalement à l'ADN. Il tente par tous les moyens d'utiliser l'ADN polymérase I d'E. coli pour copier un seul brin d'ADN. En 1975, il publie avec son équipe une première procédure de séquençage avec des nucléotides marqués avec de la radioactivité. Cette technique consiste à synthétiser des copies d'ADN simple brin de longueurs différentes, dont le dernier nucléotide incorporé est radioactif. Ces fragments sont ensuite migrés sur gel d'électrophorèse et révélés par autoradiographie et la lecture du gel du bas vers le haut révèle la séquence de l'ADN. Cette procédure permet de séquencer 80 nucléotides en une fois mais reste quand même assez laborieuse. Lui et son équipe séquencent tout de même 5 386 nucléotides du bactériophage φX174. C'est le tout premier génome entièrement séquencé au monde. Grâce à cette séquence, ils découvrent que la séquence codante de certains gènes du virus chevauche d'autres régions codantes.

Didesoxyadenosine

Didesoxyadenosine

En 1977, dans un soucis de réduction de l'utilisation de la radioactivité, Sanger et ses collègues introduisent la méthode de terminaison de chaîne avec les didesoxyribo nucléotides pour séquencer l'ADN. C'est ce que l'on appelle aujourd'hui communément la méthode Sanger. Cette nouvelle procédure permet de séquencer des fragments d'ADN beaucoup plus long d'un seul trait et avec plus de fiabilité. Ces travaux lui valent son second prix Nobel de chimie en 1980. Avec cette méthode, lui et son équipe séquencent entièrement l'ADN mitochondrial humain (16 569 paires de bases), ainsi que le bactériophage λ (48 502 paires de bases).

Vitrail dans un batiment du Wellcome Trust Genome Campus, Hinxton. (CC BY mararie)

Vitrail dans un batiment du Wellcome Trust Genome Campus, Hinxton. (CC BY mararie)

En 1983, il se retire de la science à l'âge de 65 ans, pour se consacrer à sa deuxième passion, le jardinage. En 1992, le Wellcome Trust et le MRC fondent le Sanger Center (aujourd'hui nommé Sanger Institute) en son honneur. Cet institut se trouve sur le site du Wellcome Trust Genome Campus à Hinxton, près de Cambridge. Dans un des bâtiments du village du campus, on peut trouver un vitrail commémorant l’inauguration des lieu par la famille royale d'Angleterre. On peut y lire sur le bandeau rouge en bas cette séquence d'ADN (je vous laisse le soin de la traduire) :

TGATAATAGTTCAGGGAAGATTGATCCGCAAACGGTGAGCGTTAATGATAG

Frederick Sanger a ouvert un pan aujourd'hui incontournable de la biologie. Nous lui devons ce qu'est aujourd'hui la génétique moderne et la génomique. À ce jour et depuis la création du prix, il est le seul à avoir obtenu deux prix Nobel de chimie, et fait parti du cercle très fermé des personnes ayant reçu deux prix Nobel, cercle qu'il partage avec Marie Curie, Linus Pauling et John Bardeen.

 

 

Sources:

Images:

  • Portrait de F. Sanger : Domaine Public
  • Didesoxyadenosine : Domaine Public

 

Merci à Yoann M., Hautbit et Serhaline pour la relecture.

  • À propos de
  • Passionnée d'informatique, de logiciels libres, de graphisme, touche à tout, curieuse et têtue comme une bretonne.

    Diplomée d'une licence de biologie cellulaire et moléculaire et du master de bioinformatique de Rennes; précédemment stagiaire longue durée à l'EMBL-EBI à Cambridge UK puis ingénieur d'étude au laboratoire d'informatique médicale de Rennes et actuellement doctorante en biologie/bioinformatique à l'université de Genève.

Catégorie: Actualité | Tags: , ,

2 commentaires sur “Frederick Sanger nous a quitté

  1. Monsieur Sanger...

  2. […]   […]

Laisser un commentaire

Votre adresse de messagerie ne sera pas publiée. Les champs obligatoires sont indiqués avec *

Vous pouvez utiliser ces balises et attributs HTML : <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code class="" title="" data-url=""> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> <pre class="" title="" data-url=""> <span class="" title="" data-url="">