- Le blog participatif de bioinformatique francophone depuis 2012 -

Frederick Sanger nous a quitté

Frederick Sanger (1918 - 2013)
Fre­de­rick San­ger (1918 — 2013)

Si la nou­velle ne vous est pas encore par­ve­nue, nous vous annon­çons que Fre­de­rick San­ger, le père de la géno­mique, est décé­dé le mar­di 19 novembre 2013 à l'âge de 95 ans.

Fre­de­rick San­ger est né en 1918 dans un petit vil­lage du Glou­ces­ter­shire en Angle­terre. Il étu­die les sciences natu­relles dans le pres­ti­gieux Saint John's Col­lege de Cam­bridge, puis effec­tue une thèse en méta­bo­lisme dans le dépar­te­ment de bio­chi­mie de l'Uni­ver­si­ty of Cam­bridge. Suite à sa thèse, il enchaîne dans le même labo­ra­toire sur l'étude de la com­po­si­tion de l'insuline. En moins de dix ans (de 1943 à 1951), il met en place une méthode de séquen­çage de pro­téine qui lui per­met de déter­mi­ner la séquence d'acides ami­nés com­plète des deux chaînes com­po­sant l'insuline bovine. Ces tra­vaux, qui font tom­ber le dogme de l'époque selon lequel les pro­téines était des molé­cules amorphes, sont plus que récom­pen­sés par l'obtention du prix Nobel de chi­mie en 1958.

En 1951, il quitte l'université de Cam­bridge pour tra­vailler en tant que membre du Medi­cal Research Coun­cil (MRC) où il prend un peu plus tard la tête du dépar­te­ment de chi­mie pro­téique. Après avoir triom­phé des pro­téines, Fre­de­rick se donne comme chal­lenge de venir à bout de la séquence de l'ARN de trans­fert (ARNt) de S. cere­vi­siae, en com­pé­ti­tion avec deux autres labo­ra­toires. Il perd la course mais publie néan­moins la séquence de l'ARN ribo­so­mal 5S d'E. coli.

Après avoir per­cé les secrets de l'ARN, Fre­de­rick San­ger s'attaque fina­le­ment à l'ADN. Il tente par tous les moyens d'utiliser l'ADN poly­mé­rase I d'E. coli pour copier un seul brin d'ADN. En 1975, il publie avec son équipe une pre­mière pro­cé­dure de séquen­çage avec des nucléo­tides mar­qués avec de la radio­ac­ti­vi­té. Cette tech­nique consiste à syn­thé­ti­ser des copies d'ADN simple brin de lon­gueurs dif­fé­rentes, dont le der­nier nucléo­tide incor­po­ré est radio­ac­tif. Ces frag­ments sont ensuite migrés sur gel d'électrophorèse et révé­lés par auto­ra­dio­gra­phie et la lec­ture du gel du bas vers le haut révèle la séquence de l'ADN. Cette pro­cé­dure per­met de séquen­cer 80 nucléo­tides en une fois mais reste quand même assez labo­rieuse. Lui et son équipe séquencent tout de même 5 386 nucléo­tides du bac­té­rio­phage φX174. C'est le tout pre­mier génome entiè­re­ment séquen­cé au monde. Grâce à cette séquence, ils découvrent que la séquence codante de cer­tains gènes du virus che­vauche d'autres régions codantes.

Didesoxyadenosine
Dide­soxy­ade­no­sine

En 1977, dans un sou­cis de réduc­tion de l'utilisation de la radio­ac­ti­vi­té, San­ger et ses col­lègues intro­duisent la méthode de ter­mi­nai­son de chaîne avec les dide­soxy­ri­bo nucléo­tides pour séquen­cer l'ADN. C'est ce que l'on appelle aujourd'hui com­mu­né­ment la méthode San­ger. Cette nou­velle pro­cé­dure per­met de séquen­cer des frag­ments d'ADN beau­coup plus long d'un seul trait et avec plus de fia­bi­li­té. Ces tra­vaux lui valent son second prix Nobel de chi­mie en 1980. Avec cette méthode, lui et son équipe séquencent entiè­re­ment l'ADN mito­chon­drial humain (16 569 paires de bases), ain­si que le bac­té­rio­phage λ (48 502 paires de bases).

Vitrail dans un batiment du Wellcome Trust Genome Campus, Hinxton. (CC BY mararie)
Vitrail dans un bati­ment du Well­come Trust Genome Cam­pus, Hin­x­ton. (CC BY mara­rie)

En 1983, il se retire de la science à l'âge de 65 ans, pour se consa­crer à sa deuxième pas­sion, le jar­di­nage. En 1992, le Well­come Trust et le MRC fondent le San­ger Cen­ter (aujourd'hui nom­mé San­ger Ins­ti­tute) en son hon­neur. Cet ins­ti­tut se trouve sur le site du Well­come Trust Genome Cam­pus à Hin­x­ton, près de Cam­bridge. Dans un des bâti­ments du vil­lage du cam­pus, on peut trou­ver un vitrail com­mé­mo­rant l’inauguration des lieu par la famille royale d'Angleterre. On peut y lire sur le ban­deau rouge en bas cette séquence d'ADN (je vous laisse le soin de la tra­duire) :

TGATAATAGTTCAGGGAAGATTGATCCGCAAACGGTGAGCGTTAATGATAG

Fre­de­rick San­ger a ouvert un pan aujourd'hui incon­tour­nable de la bio­lo­gie. Nous lui devons ce qu'est aujourd'hui la géné­tique moderne et la géno­mique. À ce jour et depuis la créa­tion du prix, il est le seul à avoir obte­nu deux prix Nobel de chi­mie, et fait par­ti du cercle très fer­mé des per­sonnes ayant reçu deux prix Nobel, cercle qu'il par­tage avec Marie Curie, Linus Pau­ling et John Bar­deen.

Sources :

Images :

  • Por­trait de F. San­ger : Domaine Public
  • Dide­soxy­ade­no­sine : Domaine Public

Mer­ci à Yoann M., Haut­bit et Serha­line pour la relec­ture.

Vous avez aimé ? Dites-le nous !

Moyenne : 0 /​ 5. Nb de votes : 0

Pas encore de vote pour cet article.

Partagez cet article :




Commentaires

2 réponses à “Frederick Sanger nous a quitté”

  1. Mon­sieur San­ger…

Laisser un commentaire