Découverte :
ROSALIND : devenez le meilleur bioinformaticien du monde

ROSALIND est un nouveau site web commençant à se faire un nom dans le milieu de la bioinformatique. C'est une plateforme permettant d’apprendre la bioinformatique de manière ludique en donnant des problèmes a résoudre.

Chez bioinfo-fr on aime bien et on a trouvé judicieux de vous le présenter afin que vous puissiez vous en faire votre propre avis. Bonne découverte !

V.O. uniquement

Bon, autant vous prévenir tout de suite : pour les anglophobes il faudra repasser... En effet cette nouvelle ressource est uniquement disponible dans la langue de Shakespeare. Mais peut être que si la sauce prend avec la version bêta actuelle, il y aura des petits ROSALIND déclinés en plusieurs langues dont le français. Si cela vous tente de traduire les problèmes, vous pouvez toujours contacter l'équipe ROSALIND. En attendant nous ferons avec la version actuelle qui nous est proposée par les universités de San Diego et de Saint Petersburg.

Un peu d'histoire

Plaque commémorative de Rosalind Franklin | Ryan Somma

Pour commencer, la première question qui nous vient à l'esprit est "Pourquoi ROSALIND ?". Cette question c'est à son fondateur russe qu'il faudrait la poser : Nikolay Vyahhi (twitter). C'est un clin d’œil à l'une des plus grandes scientifiques connues, Rosalind Franklin.

Petite piqûre de rappel : on lui doit entre autre les premières radiographies aux rayons X de l'ADN qui amenèrent à la découverte de la célèbre structure en hélice. Une polémique est d'ailleurs née à la suite de cela : Watson aurait été en contact avec ces radiographies avant leur publication officielle et en aurait profité allégrement. Rosalind ne sera d'ailleurs "que" remerciée dans le papier de Watson et Crick. Mais arrêtons nous là pour ce qui est de l'anecdote car nous risquerions de nous éloigner du sujet premier de cet article 🙂

Le système de problèmes à résoudre proposé sur ROSALIND est tiré des sites déjà existants comme projecteuler.net, Google Code Jam ou encore les cours en ligne mis à disposition par le MIT, Harvard et Berkeley.

L'apprentissage se fait par la pratique et en général c'est toujours mieux vu que d'apprendre par cœur bêtement un bouquin.

Fonctionnement du site

Pour citer l'équipe ROSALIND (et en traduisant) : "Nous espérons que Rosalind inspirera une nouvelle génération d'étudiants en bioinformatique, en attirant les biologistes qui veulent développer des compétences en programmation à leur propre rythme dans un environnement unique, ainsi que les programmeurs qui n'ont jamais été exposés à certains des problèmes stimulants de calcul générés par la biologie moléculaire".

Vous voilà donc le doigt dans l'engrenage et afin de pouvoir participer à la résolution d'un quelconque problème de votre choix, il vous faudra vous créer un compte. Pour cela vous aurez plusieurs possibilités : soit vous créez un compte à partir du site, soit vous vous connectez à partir de vos comptes Facebook, TwitterGoogle+ ou encore StackExchange.

Une fois connecté, vous pourrez alors vous mesurer aux autres cyber-bioinformaticiens. En effet un système de classement a été mis en place et il est possible d'observer en temps réel sa position au niveau mondial. Ils ont tout compris, l'esprit de compétition prend le dessus assez rapidement. On peut noter aussi le système de badges à la stackoverflow mis en place également : pour ceux qui ne voient pas ce qu'il en est il ne s'agit ni plus ni moins que d'un système de récompenses pour tout un tas d'actions que vous pouvez réaliser. Par exemple vous pourrez en obtenir une pour avoir résolu le problème numéro 17 le plus rapidement ou encore obtenir le rang de "Roi de la bioinfo" passé le niveau 50 (ceci sont des exemples et n'existent peut être pas, vous pouvez reposer votre chronomètre et partir à la chasse au récompenses afin de nous faire une liste de celle-ci 😉 ). Tous les ingrédients pour que la recette plaise sont réunis.

Et la cerise sur le gâteau : on vous annonce que si vous résolvez plus de 80% des problèmes présents sur le site, les portes du paradis du cyber-bioinformaticien s'ouvriront à vous. Vous aurez alors le droit de découvrir et résoudre de nouveaux problèmes inédits.

Enfin, il est bon de savoir que dès que vous cliquez sur "Download dataset", un compteur se met en marche et vous n'avez alors plus que 5 minutes pour proposer une réponse en cliquant sur "Submit". Prenez donc le temps de résoudre le problème avec le jeu de données de test fourni dans l'énoncé avant de l'appliquer au jeu de données final qui vous sera fourni lors du début du compte à rebours. Par jeu de données, j'entends par exemple une séquence d'ADN "ATGATGCCTACG" en exemple qui se transformera en "ATGCGTAGGTAAACCTGTTCAACGTGGGAT" pour la soumission de la réponse finale qui sera donc totalement différente de celle de l'exemple. Si votre réponse est fausse, vous pourrez retenter votre chance autant de fois qu'il vous faudra donc pas de panique.

Dernière précision : les jeux de données pour chaque exercice sont générés aléatoirement, vous n'aurez donc pas les mêmes données à exploiter que votre voisin de bureau si vous faites un concours entre collègues 😉


(même si c'est gratuit)

Les problèmes posés

L'équipe ROSALIND conseille de résoudre les problèmes à partir du langage Python, mais permettent également de le faire à partir de n'importe quel autre langage. On retrouve ici la tendance qui se dessine ces dernières années : le Python prend peu à peu la place de leader dans le milieu de la bioinformatique.

Les problèmes sont classés par sujet (topic) et possèdent un ID (identifiant) afin de mieux repérer ceux de votre goût dans le tableau de choix.

Capture d'écran de la section "topic" du site rosalind.info

À savoir également, vous pouvez lors de votre recherche de problème basculer en mode graphique. Cela nous rappelle fortement les graphiques à la Graphviz. Un simple clic sur une des catégories vous permet alors de constater le taux de réussite des joueurs ayant tenté leur chance. Vraiment très bien pensé !

Capture d'écran du mode vue graphique sur rosalind.info

Enfin, sachez que si le cœur vous en dit, il vous est possible de proposer vos propres problèmes à la communauté. Pour cela, il faudra cliquer sur le lien "suggest a new problem" en bas de page. À la suite de quoi, celui-ci sera validé et soumis dans un premier temps aux votes des participants avant de faire partie intégrante du bouquet de problèmes proposés.

Aide à disposition

Terminons la présentation par une belle initiative : un glossaire ! Il est assez complet et contient de très bonnes explications et de très belles illustrations. Idéal pour les néophytes ou pour un confirmé qui aurait besoin d'un petit rappel. Il est de surcroît très agréable à parcourir.

De plus une section " courses" (traduisez par "cours") est à disposition et a pour but de recenser les professeurs de bioinformatique du monde entier proposant des cours en libre accès sur leur site web. Si vous êtes vous même professeur, ou que vous en connaissez autour de vous, n'hésitez pas à vous/les référencer.

 C'est à vous !

Vous avez maintenant toutes les cartes en main, c'est donc à vous de jouer pour devenir le meilleur cyber-bioinformaticien du monde !

Serez vous le meilleur cyber-bioinformaticien du monde ? | Stilogeno

Il y a actuellement 64 problèmes à résoudre, dans de nombreux domaines que rassemble la bioinformatique.

Si vous arrivez à figurer dans le top 10, vous pourrez alors vous permettre de le placer volontiers lors d'un dîner ou sur votre CV.

Bonne bioinfo à vous !

 

Un grand merci à Muriel, Nolwenn, max, Hautbit, nahoy (et sexy loutre) et Papy tadaima pour leur relecture pré-publication sans faille.

 

  • À propos de
  • Je suis issu d'une licence de Biologie des Organismes et du Master de Bioinformatique de Bordeaux (Promo 2011).

    J'ai été bioinformaticien à l'Ecole Polytechnique Fédérale de Lausanne (EPFL) pendant 4 ans. Tout d'abord dans le laboratoire Trono puis dans le laboratoire Duboule, je fus ensuite rattaché à la plateforme de bioinformatique et de biostatistiques de l’EPFL (BBCF) où j'ai développé BioRepo, un LIMS (Laboratory Information Management System) pour les données issues de HTS.

    Depuis début 2015, je suis en poste en tant que Bioinformaticien/Software developer au sein de l’Institut de Recherche Technologique BIOASTER à Lyon.

    Enfin, j'ai l'honneur et la fierté d'être un des fondateurs/administrateurs de bioinfo-fr.net et grand supporter des Girondins de Bordeaux.

7 commentaires sur “ROSALIND : devenez le meilleur bioinformaticien du monde

  1. Rayan Chikki a fini Rosalind : http://www.homolog.us/blogs/2012/11/06/congratulations-to-rayan-chikhi/
    Mais il y aura bientôt 15 autres problèmes...

    • Bravo à lui 🙂
      Et entre l\'écriture de l\'article et sa publication on peut constater que le nombre total de problèmes est passé de 64 à 66. ROSALIND est bien vivant(e), enfin...non, mais quand même (je me comprends...)

      • Devrait y avoir ~100 problèmes d\'ici 2013.

  2. Un prise2tete.fr version bioinfo? Faudra que je teste! 🙂

  3. C\'est vraiment sympatique 🙂 Un peu dommage que la plupart des séquences sont fournies de manière \"brutes\". Le réel challenge c\'est plutôt de comprendre le format dans lequel ils veulent le retour... (pas de fasta, pas de retour charriot,... ?). Enfin comme c\'est assez ludique je leur ai fait un peu de pub quand même 😉

  4. j\'adore! je vais en parler sur mon blog et aux bio-informaticiens de l\'université de Douala

    • Content que ça plaise 😉 Passe l\'info autour de toi, ne te gênes pas ! 🙂

Laisser un commentaire